rs258013 chr5:116497833 C>A
- Sequence
acaaaaaaaatgatctccatcgcc[C/A]tctctcttttgaaaatatatttcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) epithelial cell of prostate MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.87 | 0.02 | 1.30 | n/a | No Hit | |||
| STAG1_HUMAN | 2.50 | -0.77 | 1.08 | n/a | n/a |
Items per page:
1 – 2 of 2