rs2583247 chr12:103878050 A>G
- Sequence
caagaagcacccaaggagatacaa[A/G]ttcaagactccaaactgcacatca
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma) K562 (myelogenous leukemia) COLO-829 (melanoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OCI-LY7 (diffuse large B-cell lymphoma) | 2.04 | -1.63 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.65 | -0.09 | 2.00 | |||
| COLO-829 (melanoma) | 2.51 | -4.74 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Spleen, Stomach, Testis, Thyroid, Whole_Blood