rs2585132 chr8:142739670 G>C
- Sequence
ggcacctgctgagccttcaccact[G/C]cgctcccaaagagcctggaggcct
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) breast tumor 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.23 | -1.05 | 2.00 | n/a | No Hit | |||
| SNAI2_HUMAN | n/a | 1.66 | 6.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, total cholesterol, total cholesterol change with statins, triglycerides change with statins, years of education
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood