rs2587027 chr3:146528056 T>C
- Sequence
acaataaaaaggtgagtcatatta[T/C]acataaaatattaaccccttgttt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.57 | 1.35 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, child behavior checklist dysregulation profile in children with attention deficit/hyperactivity disorder (adhd), college completion, hdl cholesterol change with statins, mitral annular calcium
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Nerve_Tibial, Pancreas, Thyroid, Whole_Blood