rs2593590 chr11:15819780 G>A
- Sequence
ttgtacaatcaaaaaggagcctac[G/A]ggatcacttctgagcaagagcgct
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) A549 (lung carcinoma) GM12891 (male B- cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.91 | 2.21 | 1.00 | |||
| A549 (lung carcinoma) | 0.67 | -0.06 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.69 | 0.07 | 1.17 | |||
| MS-1 (Small cell lung carcinoma) | 0.63 | -0.67 | 1.00 | |||
| thyroid gland | -1.64 | 2.19 | 1.00 |
Items per page:
1 – 5 of 7