rs259821 chr2:179910500 A>T
- Sequence
ctctgataatcagtctgatagagg[A/T]ttagagcctgtaagccttgcataa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.94 | 1.92 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, maternal transmission distortion, serum creatinine, total cholesterol