rs260206 chr9:110041098 A>T
- Sequence
tcaaagtgatacatggctacattc[A/T]tgtcattattccacaagatttgag
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 2.17 | -1.74 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1