rs260438 chr19:58228973 T>G
- Sequence
gagtctggcggcctcaaggttggc[T/G]cggaggtttcactgttagccgggt
- ASB in cell types
- HL-60 (acute myeloid leukemia) HepG2 (hepatoblastoma) primary B-CLL cells
- ASB for transcription factors
- INT13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| INT13_HUMAN | -1.52 | 2.01 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood