rs260503 chr19:58278729 T>C
- Sequence
catctctcggggtccgcccttgct[T/C]cctgcccacgagtgaggcctctgg
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) HEK293 (embryonic kidney) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- RBM25_HUMAN GATA1_HUMAN GABP1_HUMAN NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 2.23 | n/a | 3.00 | n/a | n/a | |||
| GATA1_HUMAN | -4.83 | 2.42 | 2.00 | n/a | No Hit | |||
| GABP1_HUMAN | 2.19 | n/a | 2.00 | n/a | n/a | |||
| NRF1_HUMAN | 0.81 | 0.06 | 2.19 | 0.96 | Weak Discordant | |||
| RFOX2_HUMAN | 1.60 | -3.65 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood