rs260672 chr2:109002117 A>G
- Sequence
gccatttgctgccccttgtgtccc[A/G]tggctgcactgcacccttgctgtc
- ASB in cell types
- D54 (H54, Human glioblastoma) erythroid progenitors GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D54 (H54, Human glioblastoma) | -1.11 | 2.34 | 2.00 | |||
| erythroid progenitors | 2.26 | n/a | 2.50 | |||
| GM02630 (Fanconi anemi) | -0.84 | 1.08 | 1.00 |
Items per page:
1 – 3 of 3