rs261216 chr5:96601700 T>A
- Sequence
tttaatgttcccactttgtacatt[T/A]cctttgtgcatctgaaaataaagt
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.38 | -2.12 | 1.00 | |||
| IPSC-derived bipolar neuron | 2.26 | 0.10 | 1.00 |
Items per page:
1 – 2 of 2