rs261339 chr15:58442290 T>C
- Sequence
gaaagagaaatgtggaagcaaagt[T/C]ctatccattttaagcatgtgacct
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | -0.32 | 2.11 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, maternal transmission distortion, transmission distortion, waist hip ratio