rs261405 chr13:21282290 T>A
- Sequence
actttgattctttggttaaggagt[T/A]tcgtcagtcagatttgtccatagt
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 2.71 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid