rs2619736 chr5:180810247 G>C
- Sequence
ggaagtgggccccggcaacgcagc[G/C]ttccacatcccgcccatttttcta
- ASB in cell types
- HepG2 (hepatoblastoma) macrophages form periferal blood GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
- ASB for transcription factors
- GABPA_HUMAN SPI1_HUMAN ZN143_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 1.81 | -1.61 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 2.34 | 0.25 | 1.96 | n/a | No Hit | |||
| ZN143_HUMAN | 2.58 | n/a | 4.00 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.75 | -0.69 | 1.67 | n/a | n/a | |||
| BC11B_HUMAN | 2.65 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 9
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood