rs2622266 chr9:113657966 C>T
- Sequence
tgcatggacatacgtatacttaca[C/T]atgtgcccacatacatgcacgtac
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.85 | 0.52 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, chronic kidney disease, comorbid depressive syndrome and alcohol dependence, fasting blood glucose, homa-ir, ldl cholesterol, total cholesterol