rs2622917 chr1:47436614 G>A
- Sequence
gggattccggcctcgcacgcccga[G/A]ctttagccactgtgcggcgctgtc
- ASB in cell types
- erythroid progenitors GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma) CD34+ hematopoietic stem cells
- ASB for transcription factors
- GABP1_HUMAN ZN217_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABP1_HUMAN | 2.63 | -2.42 | 1.00 | n/a | n/a | |||
| ZN217_HUMAN | 2.55 | -2.29 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Thyroid