rs262683 chr1:2224430 C>T
- Sequence
ggctccttaaggtgggggtctcaa[C/T]tccaaggccagcctcccaggaggc
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.79 | -0.90 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, cystatin c in serum, eur students <30 symbol search, height, maternal transmission distortion, mitral annular calcium, refractive error, serum creatinine, transmission distortion, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Testis