rs263315 chr2:157182713 A>G
- Sequence
ttgactttcagactgtttctactt[A/G]gtgcctttgctctcactaccttat
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.58 | -1.59 | 2.00 | n/a | No Hit | |||
| TF65_HUMAN | -1.78 | 2.24 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, college completion, eye color, rheumatoid arthritis