rs263811 chr13:54989590 T>C
- Sequence
ggcagaaacaaatctgctgagtcc[T/C]tctgaatgcagcaaagatttatca
- ASB in cell types
- thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | 1.89 | -3.16 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, alcohol consumption, aortic valve calcium, chronic kidney disease, hip bone mineral density (bmd), ldl cholesterol, serum creatinine