rs2645113 chr6:38024592 A>G
- Sequence
atgaatgattaaataaatggtggt[A/G]tatccatacagtggaatattactc
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma) ID00014 (lymphoblastoid cell, DiGeorge syndrome) HCT-116 (colon carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ZNF8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.10 | 1.51 | 1.38 | n/a | No Hit | |||
| ZNF8_HUMAN | 2.70 | -2.57 | 1.00 | -7.01 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg