rs265179 chr5:139985867 C>G
- Sequence
tcagggcaattatccacactcccc[C/G]caactcccaatgacccactgggag
- ASB in cell types
- HCT-116 (colon carcinoma) MCF7 (Invasive ductal breast carcinoma) monocyte-derived dendritic cells monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- CDK8_HUMAN P53_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | -2.15 | 2.42 | 1.00 | n/a | n/a | |||
| P53_HUMAN | -2.07 | 2.46 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2