rs26537 chr5:115841317 T>C
- Sequence
aggcgctcctctaaattttgcttc[T/C]ttactggccgccacccctactcgg
- ASB in cell types
- SUM159PT (Triple negative breast cancer) CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ILF3_HUMAN FOXK2_HUMAN BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ILF3_HUMAN | 3.11 | n/a | 2.00 | n/a | n/a | |||
| FOXK2_HUMAN | 2.58 | -0.20 | 1.50 | n/a | n/a | |||
| BRD2_HUMAN | 1.79 | 0.24 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, autism, hdl cholesterol change with statins, ldl cholesterol, microalbuminuria, prop taste detection threshold, rheumatoid arthritis
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood