rs266650 chr12:54759867 A>T
- Sequence
agggtatgtttgctatggggtaat[A/T]tttagctgcctgttggtctcctta
- ASB in cell types
- IPSC-derived bipolar neuron PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IPSC-derived bipolar neuron | 1.19 | -0.99 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -3.06 | 1.48 | 2.00 |
Items per page:
1 – 2 of 2