rs2670746 chr2:71299494 T>C
- Sequence
atgtagataaatacaggagtccat[T/C]gaaggtgattaaaattattgaaag
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 0.98 | -0.88 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting blood glucose, fasting insulin, homa-ir, suicide attempts in bipolar disorder (substance free)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Spleen