rs267564 chr3:37532946 A>C
- Sequence
atttcttgaatcatggcatctgct[A/C]taggaaatcctcttaaatgtattc
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 2.47 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, aortic root diameter, coronary artery disease (cad), diastolic blood pressure (dbp), eye color, major depressive disorder, mitral annular calcium, premature ovarian failure, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Skin_Sun_Exposed_Lower_leg, Whole_Blood