rs268133 chr2:65382416 A>C
- Sequence
ttgcctggaagcaggctgtcccac[A/C]cactaccctaggcagtctagggtt
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 3.01 | -3.10 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, homa-ir, late onset alzheimers disease, obesity with early age of onset (age >2), sporadic creutzfeldt-jakob disease, waist hip ratio