rs268134 chr2:65381229 A>G
- Sequence
agctcagctggtttggcaacccag[A/G]atttaaccctcccttggtgttgtg
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -2.99 | 3.05 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), college completion, fasting blood glucose, late onset alzheimers disease, serum creatinine, triglycerides, years of education