rs2685390 chr8:27992644 A>G
- Sequence
ctctaggtactgcctgagatgcga[A/G]ctgcagctgctctcgccgccagtc
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.21 | 0.88 | 2.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 0.78 | -0.75 | 1.00 |
Items per page:
1 – 2 of 2