rs2688617 chr10:73886389 A>T
- Sequence
agtccattattggtgcctccagct[A/T]tggtttcttccagtagatcactag
- ASB in cell types
- A549 (lung carcinoma) HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.82 | 0.31 | 2.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.41 | 1.57 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, diastolic blood pressure (dbp), hdl cholesterol, infant head circumference, ldl cholesterol, nicotine dependence (smoking), smoking cessation, systolic blood pressure (sbp), triglycerides, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood