rs2694406 chr12:104669395 G>C
- Sequence
gcttgttttgaatccattccccct[G/C]cagctctcagaaatggtgcaaatg
- ASB in cell types
- CHL-1 (Melanoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CHL-1 (Melanoma) | -0.42 | 1.77 | 1.00 |
Items per page:
1 – 1 of 1