rs2697788 chr2:232440722 G>A
- Sequence
gcctcggagcgacccagtatgggg[G/A]catgctgccacctgctggccacac
- ASB in cell types
- HepG2 (hepatoblastoma) PC9 (lung adenocarcinoma) erythroid progenitors GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.74 | 0.03 | 1.98 | |||
| PC9 (lung adenocarcinoma) | 1.37 | 1.00 | 2.00 | |||
| erythroid progenitors | 2.52 | n/a | 2.50 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 0.68 | -0.13 | 1.00 |
Items per page:
1 – 4 of 4