rs2705282 chr8:137934604 C>T
- Sequence
agatggttagaacctgagaatgac[C/T]cagcccctggcaagatcatttcat
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1))
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.08 | 1.66 | 1.32 | n/a | No Hit |
Items per page:
1 – 1 of 1