rs2708914 chr2:112869657 T>G
- Sequence
caaaacaaacagaaatttggggtg[T/G]gcccatggagcgtgactcatgaaa
- ASB in cell types
- K562 (myelogenous leukemia) BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) ESO-26 (Gastroesophageal junction adenocarcinoma) Ishikawa (endometrial adenocarcinoma)
- ASB for transcription factors
- KLF5_HUMAN ATF3_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF5_HUMAN | 1.14 | -1.14 | 1.00 | 0.33 | Weak Discordant | |||
| ATF3_HUMAN | 2.05 | -4.44 | 2.00 | n/a | No Hit | |||
| SMRC1_HUMAN | 1.71 | -0.65 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP alcohol dependence, primary rhegmatogenous retinal detachment, resistance to kuru in aged women despite likely exposure, spine bone mineral density (bmd), waist hip ratio