rs27097 chr16:58630161 G>T
- Sequence
tcgaggcgagggccaatagggaga[G/T]gctgataacttcgatttggggctt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma) adult erythroblasts
- ASB for transcription factors
- RBM25_HUMAN ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | n/a | 0.65 | 2.00 | n/a | n/a | |||
| ESR1_HUMAN | -0.55 | 1.81 | 2.00 | n/a | No Hit | |||
| ANDR_HUMAN | -0.45 | 2.35 | 1.62 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in nonasthmatic participants >=30 years old), diastolic blood pressure (dbp), fasting insulin, hdl cholesterol, homa-ir, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid