rs2710572 chr4:125313572 A>G
- Sequence
cttttagtctctgcatttaatttt[A/G]agcaagaaaccaggagactaaaga
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) HeLa (cervical adenocarcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.05 | n/a | 2.17 | |||
| A549 (lung carcinoma) | 1.03 | 0.94 | 1.02 | |||
| HeLa (cervical adenocarcinoma) | -2.49 | 1.73 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.80 | 0.56 | 1.07 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.09 | 0.81 | 1.94 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, homa-b, ldl cholesterol, systolic blood pressure (sbp), total cholesterol