rs271675 chr17:49902988 A>G
- Sequence
ggttatttatttgtgtctgtattc[A/G]cagcaaccttcctttcttccccag
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 2.42 | -2.26 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), ldl cholesterol, microalbuminuria, parkinsons disease, systolic blood pressure (sbp), transmission distortion, urinary albumin-to-creatinine ratio