rs2723078 chr2:65028047 G>A
- Sequence
gtagtagccgtgtgtccttgggcc[G/A]gccacttccccttcctggccttgt
- ASB in cell types
- MDM(monocyte derived macrophages) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.50 | -1.62 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 2.61 | 0.44 | 1.98 | 0.76 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis