rs2732615 chr17:46286690 T>C
- Sequence
aaaggaatttgtaatgtaagtgta[T/C]aacaaatgtagaaaaaatctgctt
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma) H929 (plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.12 | -0.66 | 3.70 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), college completion, height, infant head circumference, intracranial volume, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), obesity (body mass index (bmi)), parkinsons disease, red blood cell count (rbc), systolic blood pressure (sbp), years of education