rs2732651 chr17:46267697 C>T
- Sequence
tttccgccactgtgatttaagcac[C/T]gtcagccccacccccacgggtgag
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.96 | -0.78 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), college completion, diastolic blood pressure (dbp), height, infant head circumference, intracranial volume, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), obesity (body mass index (bmi)), parkinsons disease, red blood cell count (rbc), systolic blood pressure (sbp), total cholesterol, years of education