rs2732711 chr17:46272927 A>G
- Sequence
aatgctaacagctacagaagacat[A/G]ttaccaccaaccaaccgttgcttc
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.81 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, diastolic blood pressure (dbp), estimated total intracranial volume (excluding patients with neuropsychiatric disorders), height, infant head circumference, intracranial volume, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), parkinsons disease, red blood cell count (rbc), systolic blood pressure (sbp), years of education