rs2733913 chr16:21284062 C>G
- Sequence
acgccagggggcccacccgctgcc[C/G]gtggtcggcgcgcggagctcgaaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02255 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) epithelial cell of prostate
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.16 | 1.23 | 1.16 | 3.95 | Discordant | |||
| STAG1_HUMAN | 1.41 | 1.33 | 1.04 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid