rs274156 chr19:56172081 C>T
- Sequence
gggctttacgccccctcctggcga[C/T]agaagacatagcggctccccgact
- ASB in cell types
- WA09 (embryonic stem cells) KMS-11 (Plasma cell myeloma) GM18486 (Lymphoblastoid Cell Lines) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.34 | -0.08 | 1.26 | |||
| KMS-11 (Plasma cell myeloma) | -0.33 | 1.91 | 1.39 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 0.52 | -0.44 | 1.00 | |||
| epidermal keratinocytes | 2.21 | -1.47 | 2.00 | |||
| WA01 (H1, human embryonic stem cells) | 1.03 | 0.16 | 1.25 |
Items per page:
1 – 5 of 5