rs275446 chr5:6825877 A>T
- Sequence
acctccacaggtgtttggatacag[A/T]tcttgcacatttcttgtcagctgc
- ASB in cell types
- ARP-1(Plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 2.81 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, serum creatinine, total cholesterol, total cholesterol change with statins, triglycerides change with statins