rs276030 chr12:59466111 T>G
- Sequence
gcctcgctgaagttgcttatcagc[T/G]taaggagattttgggctgagacaa
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.26 | -4.50 | 2.00 |
Items per page:
1 – 1 of 1