rs2761733 chr9:9790379 C>G
- Sequence
gaatgacacctgtccactgtgtca[C/G]cagttggtttgcttccctgcttat
- ASB in cell types
- foreskin keratinocyte GM12892 (female B-cells lymphoblastoid cell line) right lobe of liver MCF10CA1a (breast metastatic epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.89 | 0.73 | 1.19 | -3.62 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
