rs2763031 chr6:152171382 G>T
- Sequence
agatttgagaaactcagcaaatac[G/T]ggagtgactgctatgtgcaaagaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.50 | -0.75 | 1.62 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.22 | -1.88 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hdl cholesterol, homa-b, homa-ir, ldl cholesterol, schizophrenia, total cholesterol