rs2764408 chr1:156357104 T>A
- Sequence
agggcgtggacttcgctccgccgc[T/A]aggtggcgggctggctcaggacag
- ASB in cell types
- HEK293 (embryonic kidney) smooth muscle cell CTV-1 (Adult T acute lymphoblastic leukemia) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN ZN341_HUMAN PRDM9_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.74 | 0.27 | 1.64 | -1.26 | Weak Concordant | |||
| ZN341_HUMAN | 1.64 | n/a | 2.00 | n/a | No Hit | |||
| PRDM9_HUMAN | 2.13 | -1.91 | 1.00 | n/a | n/a | |||
| SRF_HUMAN | 2.46 | -2.49 | 1.00 | n/a | No Hit | |||
| GLIS2_HUMAN | 3.11 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood