rs276514 chr6:137043493 T>G
- Sequence
cgtcagtcgtttcttcccattcag[T/G]ctacccgggaatattaaaaggaaa
- ASB for transcription factors
- RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | 1.67 | -0.93 | 1.08 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Esophagus_Mucosa, Lung, Skin_Sun_Exposed_Lower_leg