rs2787620 chr10:118590465 G>C
- Sequence
caggtagctgttggagcatgcatt[G/C]aaacactcttctgccagtttaatg
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.13 | -0.12 | 2.00 | n/a | No Hit | |||
| ANDR_HUMAN | 2.66 | 0.19 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, fasting blood glucose, height, ldl cholesterol change with statins, obesity with early age of onset (age >2), prostate cancer, total cholesterol change with statins, triglycerides