rs2796268 chr1:207751847 G>A
- Sequence
atgacggcgagccagtcctttccc[G/A]caggacgcctcaggcttccgggat
- ASB in cell types
- K562 (myelogenous leukemia) GM01310 ( Transformed lymphovlasoid cell line ) MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN EP300_HUMAN NCOR1_HUMAN HDAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.63 | 0.93 | 1.15 | n/a | No Hit | |||
| EP300_HUMAN | 1.31 | 0.40 | 1.10 | n/a | n/a | |||
| NCOR1_HUMAN | 0.66 | 2.56 | 3.00 | n/a | n/a | |||
| HDAC2_HUMAN | -5.36 | 2.28 | 3.00 | n/a | n/a | |||
| AHR_HUMAN | 1.79 | -0.13 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen